Web Results

Complementarity (molecular biology) - Wikipedia, the free ...

en.wikipedia.org/wiki/Complementarity_(molecular_biology)

In molecular biology, complementarity describes a relationship between two structures each ... A complementary strand of DNA or RNA may be constructed based on nucleobase complementarity. Each base ...

Complementary strand | Define Complementary strand at Dictionary ...

www.dictionary.com/browse/complementary-strand

Complementary strand definition, either of the two chains that make up a double helix of DNA, with corresponding positions on the two chains being composed ...

Reverse Complement - Bioinformatics.org

www.bioinformatics.org/sms/rev_comp.html

You may want to work with the reverse-complement of a sequence if it contains an ORF on the reverse strand. Paste the raw or FASTA sequence into the text ...

Complementary strands - Biology-Online Dictionary

www.biology-online.org/dictionary/Complementary_strands

Oct 3, 2005 ... Complementary strands. (Science: molecular biology) two single strands of dna in which the nucleotide Sequence is such that they will bind as ...

Complementary Sequences

www.chem.wisc.edu/deptfiles/genchem/netorial/modules/biomolecules/modules/dna1/dna16.htm

Because of the nature of complementary base pairing, if you know the sequence of one strand of DNA, you can predict the sequence of the strand that will pair ...

What does it mean when a DNA strand is complementary? - Quora

www.quora.com/What-does-it-mean-when-a-DNA-strand-is-complementary

A complementary strand will have the complementary sequence of nucleotides as the other strand. So a strand 3'-atgc-5' will be complimented by 5'-tacg-3'.

Cells Can Replicate Their DNA Precisely | Learn Science at Scitable

www.nature.com/scitable/topicpage/cells-can-replicate-their-dna-precisely-6524830

Later, when the new strand is itself copied, its complementary strand will contain the same sequence as the original template strand. Thus, as a result of ...

DNA replication

en.wikipedia.org/wiki/DNA_replication

In molecular biology, DNA replication is the biological process of producing two identical replicas of DNA from one original DNA molecule. This process occurs in all living organisms and is the basi...

What is DNA replication? | Facts | yourgenome.org

www.yourgenome.org/facts/what-is-dna-replication

Jan 25, 2016 ... The two separated strands will act as templates for making the new strands of DNA. ... strand and then 'walks' along it, adding new complementary<sup>?</sup> ... half of the chain is part of the original DNA molecule, half is brand new.

Popular Q&A
Q: What is the complementary strand of DNA?
A: A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined? Read More »
Source: wiki.answers.com
Q: What is the complementary strand for ctacgctaggcgattgaact?
A: GATGCGATCCGCTAACTTGA. T turns to A, A turns to T, G turns to C, and C turns to G. Read More »
Source: wiki.answers.com
Q: What is the complementary strand for gcctaa.
A: it is CGGATT in case of DNA while in the case of RNA, it is CGGAUU. Read More »
Source: www.answers.com
Q: What is the complementary strand for AAGCAA.
A: The complementary DNA strand would be TTCGTT. But assuming that the given strand is of mRNA, the DNA template would be TTCGTT and the tRNA would be UUCGUU. Read More »
Source: www.answers.com
Q: What is a complementary strand?
A: A complementary strand of DNA contains the template information for the creation of a new copy of the other Read More »
Source: www.chacha.com