Web Results

Ca2+ stores in Purkinje neurons - Journal of Neuroscience


strong et al., 1987) a structure specially suited to mediate a rapid and reversible .... the kind gift of D. Campbell and D. Fambrough (Johns Hopkins Uni- versity, Baltimore ... pieces, which were mildly homogenized in about sixfold (w/v) ice- cold homogenation .... (pm) and an adjacent glial cell process (gc) can be seen in b.

BMC Psychiatry | Full text | The glial growth factors deficiency and ...


Jul 3, 2002 ... 2002 Moises et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted ...

Molecular control of neuromuscular junction development


Jones G, Meier T, Lichtsteiner M, Witzemann V, Sakmann B, Brenner HR. ... Jennings CG, Dyer SM, Burden SJ. ... Kim N, Stiegler AL, Cameron TO, Hallock PT, Gomez AM, Huang JH, et al. ..... Fambrough DM, Drachman DB, Satyamurti S . Neuromuscular junction in myasthenia gravis: decreased acetylcholine receptors.

Differential Immediate Early Gene Expression Induced by


Apr 10, 2001 ... Sweeney et al., 1 ... Douglas Fambrough. 3,4 ...... Cameron, H. A., Hazel, T. G., and McKay, R. D. (1998) J. Neurobiol 36, 287-306. 14. Marshall ...

Vesiculation and sorting from PC12-derived endosomes in vitro


Sep 15, 1998 ... (3), described in detail in Clift-O'Grady et al. (11). ..... The αF6 antibody developed by Douglas M. Fambrough was obtained from the Developmental Studies Hybridoma Bank .... Stoorvogel W,; Strous G J,; Geuze H J,; Oorschot V,; Schwartz A L ... Cameron, P., Mundigl, O. & De Camilli, P. (1993) J. Cell Sci.

Get PDF - Wiley Online Library


Oct 14, 2011 ... Jones G, Meier T, Lichtsteiner M, Witzemann V, Sakmann B,. Brenner HR. ... Jennings CG, Dyer SM, Burden SJ. ... Kim N, Stiegler AL, Cameron TO, Hallock PT, Gomez AM, ... Y, et al. Dok-7 activates the muscle receptor kinase MuSK and .... Fambrough DM, Drachman DB, Satyamurti S. Neuromuscular.

Full Text - Molecular Biology of the Cell


Aug 1, 2000 ... Because the t 1/2 for TR recycling is ∼16 min (Mukherjee et al., 1997) and the ... CCCTGCTCCTCGCTGGCGCGGCCGCCTTTATGATTGGC, and the primer for the ..... chicken lysosomal membrane protein (Lippincott-Schwartz and Fambrough, 1986, 1987). ..... Bradbury L.E.,; Goldmacher V.S.,; Tedder T.F..

Download Now - Experience Based Learning Systems, Inc


Almeida. P. et. al. (2010). Approaches to Learning and Kolb's Learning Styles of .... Antismoking initiatives: Effects of analysis vs ... Bergsteiner, H. & Avery, G. C. ( 2008). .... Cameron, J. M. (2006). ..... Fambrough, M. & Comerford, S. A.(2006).

Download as PDF - Scientific Research Publishing


M. K. BALL ET AL. 139 gate and ..... [3] M. Numberger, I. Durr, W. Kues, M. Koenen and V. Witzemann .... [21] D. M. Fambrough, “Control of Acetylcholine Receptors in Skeletal ... [30] M. Gautam, P. G. Noakes, J. Mudd, M. Nichol, G. C. Chu,. J. R. Sanes ... [37] N. Kim, A. L. Stiegler, T. O. Cameron, P. T. Hallock, A. M. Gomez ...

Processus groupaux au sein d'équipes sportives de haut niveau


13 oct. 2011 ... Albert V. Carron ... Chapitre 3 : Cohésion et ambiguïté du rôle au sein d'équipes sportives de haut niveau… .... Cadre conceptuel pour l'étude des équipes sportives (Carron et al., 2005, p. ... Selon Fambrough et Comerford (2006), ces ..... GC. *. * performance individuelle dans entre ses efforts et un résultat.

Helpful Resources

Alterations of cAMP-dependent signaling in dystrophic skeletal muscle


Oct 17, 2013 ... Next, Akaaboune et al. demonstrated that AChR is recycled to the postsynaptic ... (e.g., dwell at postsynaptic membrane vs. endocytose; recycle vs. degrade) and ...... A. L., Cameron T. O., Hallock P. T., Gomez A. M., Huang J. H., et al. ..... Prakash Y. S., Van Der Heijden H. F., Gallant E. M., Sieck G. C. (1999).

Retrograde Traffic Out of the Yeast Vacuole to the TGN Occurs via ...


Finally we show that Vti1p, a v-SNARE required for the delivery of both CPY and ALP to the ... and Fambrough, 1987; Akasaki et al., 1993, 1995; Reaves et al., 1996). .... LWY2809 is a sister spore of LWY2806 (Bonangelino et al., 1997). ...... [ PubMed]; Ammerer G, Hunter CP, Rothman JH, Saari GC, Valls LA, Stevens TH.

The neuromuscular junction: Selective remodeling of synaptic ...


Sep 29, 2012 ... The receptor associated protein rapsyn (Frail et al., 1988) is a cytoskeletal ... The postnatal conditional KO of MuSK (Hesser et al., 2006) demonstrates that ..... or denervation destabilize AChRs and cause rapid turnover (Fambrough, 1979). .... Brenner et al., 1990; H.R. Brenner, V. Witzemann, B. Sakmann.

Oncogene - Gene expression profiling of ErbB receptor and ligand ...


Dec 1, 2003 ... Earlier work by Fambrough et al. ... 2a, which engage a common receptor (da Silva et al., 2002). ..... Krizman DB, Tangrea MA, Ahram M, Linehan WM, Knezevic V and Emmert-Buck MR. ... Article | PubMed | ISI | ChemPort |; Hobbs SS, Coffing SL, Le AT, Cameron EM, Williams EE, Andrew M, Blommel EN, ...

Full Text - Development - The Company of Biologists


Dec 22, 2003 ... (Hutter et al., 2000) and by Teichmann and Chothia (Teichmann and Chothia, 2000). .... IgSF proteins in C. elegans were described previously (Hutter et al., 2000; ..... (Fambrough and Goodman, 1996), Sidestep on its own (Sink et al., 2001), ..... Pipes, G. C., Lin, Q., Riley, S. E. and Goodman, C. S. (2001).