Web Results

List of RNA structure prediction software - Wikipedia, the free ...

en.wikipedia.org/wiki/List_of_RNA_structure_prediction_software

This list of RNA structure prediction software is a compilation of software tools and web portals used for RNA structure prediction.

Welcome to the Predict a Secondary Structure Web Server

rna.urmc.rochester.edu/RNAstructureWeb/Servers/Predict1/Predict1.html

The Predict a Secondary Structure server combines four separate prediction and ... This server takes a sequence, either RNA or DNA, and creates a highly ...

CYLOFOLD: RNA Structure Prediction

cylofold.ncifcrf.gov/

RNA Secondary Structure Prediction with Pseudoknots. Enter job ID to retrieve results of previous submission: Select Input Format. Raw Sequence demo

RNA secondary structure prediction - GeneBee

www.genebee.msu.su/services/rna2_reduced.html

May 16, 2001 ... Alignment example: Sequence example: ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF ...

Which software tools for RNA structure prediction? - OMICtools

omictools.com/rna-structures-category

Here, we surveyed desktop applications, web applications, cloud computing tools , libraries for predicting RNA structures.

RNAstructure: software for RNA secondary structure prediction and ...

bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-11-129

RNAstructure is a software package for RNA secondary structure prediction and analysis. It uses thermodynamics and utilizes the most recent set of nearest ...

RNAsoft - home page

www.rnasoft.ca/

RNAsoft - Software for RNA/DNA secondary structure prediction and design ... AveRNA combines the RNA secondary structures predicted by different ...

RNA structure prediction: an overview of methods. - NCBI

www.ncbi.nlm.nih.gov/pubmed/22736001

Methods Mol Biol. 2012;905:99-122. doi: 10.1007/978-1-61779-949-5_8. RNA structure prediction: an overview of methods. Seetin MG(1), Mathews DH.

Folding and Finding RNA Secondary Structure

www.ncbi.nlm.nih.gov/pmc/articles/PMC2982177/

When a new RNA is discovered, experiments and sequence comparison can .... Because the accuracy of secondary structure prediction is limited in part by an ...

RNAsoft: a suite of RNA secondary structure prediction and design ...

www.ncbi.nlm.nih.gov/pmc/articles/PMC169018/

Software tools that predict the secondary structure of a DNA or RNA strand from the base sequence, such as mfold (1) and RNAfold from the Vienna RNA ...

More Info

The Mfold Web Server | mfold.rit.albany.edu

unafold.rna.albany.edu

RNA Folding Form · DNA Folding Form · Structure Display and Free Energy ... 2000 to November 5, 2010, when it was relocated to the RNA Institute web site.

RNA analysis - Online Analysis Tools

molbiol-tools.ca

Ridom - Ribosomal RNA analysis for clinically relevant bacteria - (University of .... Vienna RNA secondary structure prediction (University of Vienna, Austria).