Web Results

en.wikipedia.org/wiki/List_of_RNA_structure_prediction_software

This list of RNA structure prediction software is a compilation of software tools and web portals used for RNA structure prediction.

rna.urmc.rochester.edu/RNAstructureWeb/Servers/Predict1/Predict1.html

RNAstructure Webserver - RNA Secondary Structure Prediction and Analysis. ... This server takes a sequence, either RNA or DNA, and creates a highly ...

unafold.rna.albany.edu/?q=mfold

RNA Folding Form · DNA Folding Form · Structure Display and Free Energy ... 2000 to November 5, 2010, when it was relocated to the RNA Institute web site.

cylofold.ncifcrf.gov

CYLOFOLD. RNA Secondary Structure Prediction with Pseudoknots. Enter job ID to retrieve results of previous submission: Select Input Format. Raw Sequence ...

rna.tbi.univie.ac.at

Thermodynamic Structure Prediction. RNAfold Server ...predicts minimum free energy structures and base pair probabilities from single RNA or DNA sequences .

www.rnasoft.ca

RNAsoft - Software for RNA/DNA secondary structure prediction and design ... AveRNA combines the RNA secondary structures predicted by different ...

molbiol-tools.ca/RNA_analysis.htm

Ridom - Ribosomal RNA analysis for clinically relevant bacteria - (University of .... Vienna RNA secondary structure prediction (University of Vienna, Austria).

omictools.com/rna-structures-category

Find and compare the best bioinformatics software for predicting RNA tertiary structures. Tools are ranked by the biomedical research community.

www.genebee.msu.su/services/rna2_reduced.html

May 16, 2001 ... Alignment example: Sequence example: ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF ...

bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-11-129

Mar 15, 2010 ... RNA secondary structure prediction, using thermodynamics, can be used to develop hypotheses about the structure of an RNA sequence.