Web Results

List of RNA structure prediction software - Wikipedia

en.wikipedia.org/wiki/List_of_RNA_structure_prediction_software

This list of RNA structure prediction software is a compilation of software tools and web portals used for RNA structure prediction.

Welcome to the Predict a Secondary Structure Web Server

rna.urmc.rochester.edu/RNAstructureWeb/Servers/Predict1/Predict1.html

The Predict a Secondary Structure server combines four separate prediction and ... This server takes a sequence, either RNA or DNA, and creates a highly ...

The Mfold Web Server | mfold.rit.albany.edu

unafold.rna.albany.edu/?q=mfold

RNA Folding Form · DNA Folding Form · Structure Display and Free Energy ... 2000 to November 5, 2010, when it was relocated to the RNA Institute web site.

RNAsoft - home page

www.rnasoft.ca/

RNAsoft - Software for RNA/DNA secondary structure prediction and design ... AveRNA combines the RNA secondary structures predicted by different ...

RNA secondary structure prediction from sequence alignments ...

rnajournal.cshlp.org/content/12/3/342.full

The input to the network is the mutual information, the fraction of complementary nucleotides, and a novel consensus RNAfold secondary structure prediction of ...

RNA structure prediction: an overview of methods. - NCBI

www.ncbi.nlm.nih.gov/pubmed/22736001

Methods Mol Biol. 2012;905:99-122. doi: 10.1007/978-1-61779-949-5_8. RNA structure prediction: an overview of methods. Seetin MG(1), Mathews DH.

RNAstructure: software for RNA secondary structure prediction and ...

bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-11-129

Mar 15, 2010 ... RNA secondary structure prediction, using thermodynamics, can be used to develop hypotheses about the structure of an RNA sequence.

Freiburg RNA Tools

rna.informatik.uni-freiburg.de/

IntaRNA enables the prediction of RNA-RNA interactions. ... Thus, LocARNA aligns RNAs with unknown structure and predicts a consensus secondary structure ...

Basics of RNA structure prediction

www.phys.ens.fr/~monasson/Houches/Westhof/L7.pdf

Basics of RNA structure prediction. • Two primary methods of structure prediction. – Covariation analysis/Comparative sequence analysis. • Takes into account ...

ViennaRNA Web Services

rna.tbi.univie.ac.at/

Thermodynamic Structure Prediction. RNAfold Server ...predicts minimum free energy structures and base pair probabilities from single RNA or DNA sequences .

More Info

CYLOFOLD: RNA Structure Prediction

cylofold.ncifcrf.gov

RNA Secondary Structure Prediction with Pseudoknots. Enter job ID to retrieve results of previous submission: Select Input Format. Raw Sequence demo

RNA secondary structure prediction - GeneBee

www.genebee.msu.su

May 16, 2001 ... Alignment example: Sequence example: ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF ...

RNA analysis - Online Analysis Tools

molbiol-tools.ca

FOLDALIGN - folds and aligns RNA structures (make a foldalignment) based on a ... Vienna RNA secondary structure prediction (University of Vienna, Austria).