Web Results

List of RNA structure prediction software - Wikipedia

en.wikipedia.org/wiki/List_of_RNA_structure_prediction_software

This list of RNA structure prediction software is a compilation of software tools and web portals used for RNA structure prediction.

Welcome to the Predict a Secondary Structure Web Server

rna.urmc.rochester.edu/RNAstructureWeb/Servers/Predict1/Predict1.html

RNAstructure Webserver - RNA Secondary Structure Prediction and Analysis.

Welcome to the Mathews Lab RNAstructure Web Servers

rna.urmc.rochester.edu/RNAstructureWeb/

RNAstructure Webserver - RNA Secondary Structure Prediction and Analysis.

Mathews Lab RNAstructure Download

rna.urmc.rochester.edu/RNAstructure.html

RNAstructure is a complete package for RNA and DNA secondary structure prediction and analysis. It includes algorithms for secondary structure prediction,  ...

CYLOFOLD: RNA Structure Prediction

cylofold.ncifcrf.gov/

CYLOFOLD. RNA Secondary Structure Prediction with Pseudoknots. Enter job ID to retrieve results of previous submission: Select Input Format. Raw Sequence ...

RNA secondary structure prediction - GeneBee

www.genebee.msu.su/services/rna2_reduced.html

May 16, 2001 ... Alignment example: Sequence example: ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF ...

ViennaRNA Web Services

rna.tbi.univie.ac.at/

Thermodynamic Structure Prediction. RNAfold Server ...predicts minimum free energy structures and base pair probabilities from single RNA or DNA sequences .

The Mfold Web Server | mfold.rit.albany.edu

unafold.rna.albany.edu/?q=mfold

It operated at Rensselaer Polytechnic Institute from October 2000 to November 5, 2010, when it was relocated to the RNA Institute web site. As of the relocation ...

RNA analysis - online analysis tools

molbiol-tools.ca/RNA_analysis.htm

FOLDALIGN - folds and aligns RNA structures (make a foldalignment) based on a ... Vienna RNA secondary structure prediction (University of Vienna, Austria).

RNA structure prediction: an overview of methods. - NCBI

www.ncbi.nlm.nih.gov/pubmed/22736001

Methods Mol Biol. 2012;905:99-122. doi: 10.1007/978-1-61779-949-5_8. RNA structure prediction: an overview of methods. Seetin MG(1), Mathews DH.