Web Results

List of RNA structure prediction software - Wikipedia, the free ...

en.wikipedia.org/wiki/List_of_RNA_structure_prediction_software

This list of RNA structure prediction software is a compilation of software tools and web portals used for RNA structure prediction.

Welcome to the Predict a Secondary Structure Web Server

rna.urmc.rochester.edu/RNAstructureWeb/Servers/Predict1/Predict1.html

The Predict a Secondary Structure server combines four separate prediction and ... This server takes a sequence, either RNA or DNA, and creates a highly ...

RNAfold - Vienna RNA Webserver - Universität Wien

rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi

RNA secondary structure prediction - GeneBee

www.genebee.msu.su/services/rna2_reduced.html

May 16, 2001 ... Alignment example: Sequence example: ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF ...

RNAstructure: software for RNA secondary structure prediction and ...

bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-11-129

RNAstructure is a software package for RNA secondary structure prediction and analysis. It uses thermodynamics and utilizes the most recent set of nearest ...

The Mfold Web Server | mfold.rit.albany.edu

unafold.rna.albany.edu/?q=mfold

RNA Folding Form · DNA Folding Form · Structure Display and Free Energy ... 2000 to November 5, 2010, when it was relocated to the RNA Institute web site.

Basics of RNA structure prediction

www.phys.ens.fr/~monasson/Houches/Westhof/L7.pdf

Basics of RNA structure prediction. • Two primary methods of structure prediction. – Covariation analysis/Comparative sequence analysis. • Takes into account ...

RNAsoft - home page

www.rnasoft.ca/

RNAsoft - Software for RNA/DNA secondary structure prediction and design ... AveRNA combines the RNA secondary structures predicted by different ...

RNA structure prediction: an overview of methods. - NCBI

www.ncbi.nlm.nih.gov/pubmed/22736001

Methods Mol Biol. 2012;905:99-122. doi: 10.1007/978-1-61779-949-5_8. RNA structure prediction: an overview of methods. Seetin MG(1), Mathews DH.

RNAstructure: software for RNA secondary structure prediction and ...

www.ncbi.nlm.nih.gov/pubmed/20230624

BMC Bioinformatics. 2010 Mar 15;11:129. doi: 10.1186/1471-2105-11-129. RNAstructure: software for RNA secondary structure prediction and analysis.

More Info

Welcome to the Mathews Lab RNAstructure Web Servers

rna.urmc.rochester.edu

MaxExpect: Generate a structure or structures composed of highly probable base pairs. This is an alternative method for structure prediction that may have ...

CYLOFOLD: RNA Structure Prediction

cylofold.ncifcrf.gov

RNA Secondary Structure Prediction with Pseudoknots. Enter job ID to retrieve results of previous submission: Select Input Format. Raw Sequence demo

RNA analysis - Online Analysis Tools

molbiol-tools.ca

Ridom - Ribosomal RNA analysis for clinically relevant bacteria - (University of .... Vienna RNA secondary structure prediction (University of Vienna, Austria).